Art
Engaging the Public in Modernising Medical Microbiology Through Art
Anna Dumitriu is currently a Leverhulme Artist in Residence for the UKCRC (MMM) Modernising Medical Microbiology Consortium. As part of her residency she is shadowing researchers in this consortium that work with M. tuberculosis, S. aureus (and its drug resistant form MRSA), Norovirus and C. difficile. The aim of her work is to communicate the UKCRC MMM consortium aims and research to the general public through the format of art.
Anna has created a "The MRSA Quilt" that tells the story of MRSA (Methicillin Resistant Staphylococcus aureus) research and diagnosis through a textile work stained with MRSA bacteria (grown on chromogenic agar) as it undergoes a number of commonly used tests. The final work has been autoclaved and made safe. It has been made in collaboration with Dr John Paul, Dr James Price and Rosie Sedgwick.
Further images of the MRSA quilt
Why create a MRSA quilt?
There is huge gap between the public’s understanding of the issue of hospital acquired pathogens or ‘superbugs’ as the press describe them. MRSA is a mutated form of Staphylococcus aureus which is part of our normal bacterial flora and thought to be carried by around 25% of the population (this figure could potentially be much higher as it may simply be that our testing methods are flawed). MRSA has acquired genes which mean that it can withstand treatment with Methicillin based antibiotics. However Vancomycin is usually still effective. MRSA is not only acquired from hospitals, there is also community acquired MRSA. In hospitals patients are more susceptible to infections if they are immune compromised or have operation woulds hence the risk of MRSA there. Patients are routinely tested. However transmission vectors (how the bug moves from person to person) are not properly understood and the Modernising Medical Microbiology Project is now using whole genome mapping of bacteria to try to understand far more about this important factor.
The spa gene (surface protein A gene) of the Staphylococcus aureus (non MRSA) found to be living in Dumitriu’s nose is:
GCACCAAAAGAGGAAGACAACAACAAGCCTGGTAAAGAAGACGGCAACAAACCTGGTAAAGAAGACAACA
AAAAACCTGGCAAAGAAGACGGCAACAAACCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGACAA
CAACAAAMCTGGTAAAGAAGACGGCAACAAGCCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGAC
CAACAAAMCTGGTAAAGAAGACGGCAACAAGCCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGAC
GGCAACAAACCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGACGGCAACGGAGTACATGTCGT
Looking at the spa gene is a typing method for Staphylococcus aureus, Dumitriu colonised with is spa type t015, which corresponds to sequence type ST45 (not the most common type seen in hospitals).
By making her colonisation with Staphylococcus aureus explicit, Dumitriu is demonstrating the gap between the media’s presentation of this bug and the scientific reality. The point being we are colonised by a huge number of bacteria, many of which are integral to our well-being. The science behind this work is revealing that there is a far greater story to be told than the “dirty hospitals” rhetoric of the press and Dumitriu’s work offers a way in to the story for many people who would otherwise have no access to it. Quilts are a traditional way of passing down stories. Dumitriu’s MRSA project continues.
Dumitriu has also now been trained to shadow work safely in a Category 3 Laboratory and will shortly be commencing the next stage of the residency which will involve research into Mycobacterium tuberculosis which causes TB. TB is the world’s largest infectious killer and is carried by around one third of the population of this planet.
The MRSA Quilt has been shown at the R-Space at The Linen Rooms in Lisburn, Northern Ireland and the V & A Museum in London as part of the Digital Design Weekend for the London Design Festival. Further exhibitions and a catalogue are planned.
As part of the Oxford Biomedical Research Centre Open Day in March 2012, Anna Dumitriu led a 'drop in' MRSA/MSSA (Methicillin resistant and susceptible Staphylococcus aureus bacteria) quilt making session. Participants were able to create quilt squares using natural and clinical antibiotics on Chromogenic agar and then the squares were (remotely) inoculated with bacteria and the results can be seen here, at the end of the Modernising Medical Microbiology page. The squares will also used to create a new artwork which will be exhibited at Anna Dumitriu's forthcoming show at St John's College Barn Gallery in Oxford in May 2012.
